Alberto - good work on getting to sequencing. I am looking forward to see if you guys can get it in the Spring. -- Dr. B 121214
Weeks 14, 15
Analysis
The GOLD scores obtained from the virtual screening runs where organized in one table. The NIH library was shown to be the most important library for research as the highest scoring ligands came from it.
Analysis
The sequences obtained show that cloning did not work. The samples were not run properly. This was most likely to low quality samples. As there was not sample left, cloning needs to be retried.
12042014-0 Missing week 13, good job however
Weeks 11, 12, 13
Analysis
There is not many information to collect between the steps of cloning that indicate if the process is going towards a positive clone. All that can be known is if that step gave a result, but nothing is know about what actually is in the sequence. There might be errors in the sequence due to many factors. The way to check if the clone worked is through sequencing.
Conclusion
Cloning is a complicated process , nevertheless the result is very important towards the project because it will used to express the target protein. Together with virtual screening, this protocol will lead to the next part of target discovery.
Cloning
Figure 5. Nanodrop check of plasmid concentration after Miniprep of the transformed cells. concentration of plasmid was 90.9ng/ul.
Image 3. MptpA pellet after overnight incubatrion in 5mL of LB media.
Image 2. Plate containing 2ul of T-4 treated Accepting vector and 4ul of T-4 treated insert. Plate made with LB, Kanamycin and Sucrose. No colonies present.
Image 1. Plate containing 4ul of T-4 treated Accepting vector and 4ul of T-4 treated insert. Plate made with LB, Kanamycin and Sucrose. Only one colony.
Weeks 8, 9, 10
1162014- Nice Work Analysis
The gel done for PCR squared showed that the yield might have been too low (the bands were very light). Another round of PCR squared was done and all of the sample were cleaned up into the same tube. The yield for the plasmid was shown to be 200.4 ng/µl after cleanup. PCR squared is a relatively simple procedure. The complications of it are mainly due to the polymerase used. If the polymerase denatures due to temperatures changes, it will become useless. In this procedure, Q5 hotstart polymerase was used. The enzyme should be out of the fridge for the least amount of time possible.
PCR cleanup is used to purify what was obtained from the PCR procedures. dNTPs and polymerase contaminants are removed from the solution. DNA sample will be lost if the buffers are not prepared according to what is said in the protocol. The wash solution contains ethanol (must be added). If the container is left open, the ethanol will evaporate affecting further uses of the wash solution.
Conclusion
The gene that was obtained will be inserted into the pNIC-bsa4 plasmid (purified through midi-prep). The gene will be used to express our target protein.
PCR Cleanup
10/27/2014
Figure 2. PCR cleanup Nanodrop check. Concentration was 200.4 ng/ul.
PCR squared
10/13/2014
Figure 1. PCR Squared agarose gel. Lane 1: 1bp ladder (New England Biolabs) ; Ladders 2-5: 5µl of PCR Squared Sample, 10µl of DH2O, and 3µl of blue juice.
Midi-prep Trial 2
10/14/2014
Analysis The second trial gave a higher yield of pNIC-Bsa4. Factors that improved to increase the yield are that previous practice of the protocol helped to make no mistakes (avoid any back pressure on the filter and improvement in the amount of time spent on the procedure) , that the filter did not break (during the first trial it leaked), and that the plasmid was placed in a smaller volume of liquid. Nevertheless, the yield was still small as decreasing the volume of the first trial would have given a concentration higher than that if the second trial.
10232014- Fantastic, job well done!
Weeks 5, 6 & 7
Primary and Secondary PCR
Analysis
The PCR gels show that the procedure was done correctly and the DNA sequence was formed. It is still likely that there are some contaminations or that there is a DNA sequence with about the same size of our gene. Sequencing must be done in order to prove that the sequence wanted is there.
Three gels were made. The first one (Figure 1) showed almost no results. There were some signs of a smear, but it did not show bands that could give a conclusion. This was most likely due to using the wrong amounts of sample and blue juice for the gel. The sample was too diluted. Then, a second gel was made instead of repeating the Primary PCR protocol, to confirm that the gel was not showing a false negative. The second gel showed that both PCR procedures worked, although Secondary PCR was still too light. After that, Secondary PCR was repeated, but this time, instead of using the first and last oligonucleotides, custom primers were used to make the DNA. The last gel (Figure 3) showed a dark band at the expected size.
The next step would be to use the PCR squared technique to make more DNA before purifying and sequencing.
11/10/2014
Figure 3. Secondary PCR results (Lane 2). 100bp Ladder on L1 (New England Biolabs).
10/06/2014
Figure 2. Agarose gel containing Primary PCR results (L3) and Secondary PCR results (L4). 100bp Ladder is in the leftmost lane (New England Biolabs).
10/3/2014
Figure 1. Primary ( L7) and Secondary PCR (L8), gel first trial. 15µl were used in each well. 1kb ladder from New England Biolabs found on L1.
Midi- prep
Analysis
Midi-prep is a technique used to isolate the plasmid expressed in bacteria. The plasmid is used for cloning, but it needs further preparation after being purified. The midi-prep procedure uses a series of filter and elutions that wash the unwanted components of the cell leaving only the plasmid. After midi-prep is done, the concentration of the product is checked using Nanodrop Spectrophotometry. The concentration obtained was low. A higher value is more convenient to use on further procedures.
10/02/2014
Figure 3. Trial 3 Midiprep nanodrop. Concentration of plasmid was 33.2ng/µl.
Figure 2. Trial 2 Midiprep nanodrop. Concentration of plasmid was 33.2ng/µl.
Figure 1. Trial 1 Midiprep nanodrop. Concentration of plasmid was 33.2ng/µl.
PCR Primer Design Tails for pNIC-Bsa4 Cloning
09/29/2014
Analysis Designing PCR Primers requires being careful when working with the DNA sequences. The right sequence should be used (optimized sequence or original) depending on the organism that will be used to express the protein. The programs (online) used to design primers are able to identify where the enzyme is going to cut. It is also possible to simulate an agarose gel to know what to expect when doing the procedures.
Conclusion The procedure is the step before secondary PCR can be done. The primers will be used to make more copies of the DNA of interest. Knowing where the DNA will be cut is essential to be able to confirm that the plasmid was cut in the right places. If the plasmid is cut properly, gene insertion will be possible to continue with cloning.
Figure 1. BsaI Cut A of pNIC-Bsa4. Cut predicted by NEB cutter website. Circular DNA shown as linear.
Figure 2. BsaI Cut B of pNIC-Bsa4. Cut predicted by NEB cutter website. Circular DNA shown as linear.
Figure 3. Circular DNA plasmid pNIC-Bsa4 cut using NEB cutter website.
Figure 4. Virtual gel of pNIC-bsa4 Enzyme digest with BsaI.
Weeks 3 & 4
PCR Primer Design for Overlap Assembly
Analysis
The nucleotide sequences that were found will be used as the pieces of the gene wanted. The sequences will bind in an specific order when Primary PCR is done. The sequences will overlap based on their ends. MPtpA will be formed to be later used for cloning. It will be inserted into the pNIC-bsa4 plasmid.
Weeks 14, 15
Analysis
The GOLD scores obtained from the virtual screening runs where organized in one table. The NIH library was shown to be the most important library for research as the highest scoring ligands came from it.
Analysis
The sequences obtained show that cloning did not work. The samples were not run properly. This was most likely to low quality samples. As there was not sample left, cloning needs to be retried.
12042014-0 Missing week 13, good job however
Weeks 11, 12, 13
Analysis
There is not many information to collect between the steps of cloning that indicate if the process is going towards a positive clone. All that can be known is if that step gave a result, but nothing is know about what actually is in the sequence. There might be errors in the sequence due to many factors. The way to check if the clone worked is through sequencing.
Conclusion
Cloning is a complicated process , nevertheless the result is very important towards the project because it will used to express the target protein. Together with virtual screening, this protocol will lead to the next part of target discovery.
Cloning
Weeks 8, 9, 10
1162014- Nice WorkAnalysis
The gel done for PCR squared showed that the yield might have been too low (the bands were very light). Another round of PCR squared was done and all of the sample were cleaned up into the same tube. The yield for the plasmid was shown to be 200.4 ng/µl after cleanup. PCR squared is a relatively simple procedure. The complications of it are mainly due to the polymerase used. If the polymerase denatures due to temperatures changes, it will become useless. In this procedure, Q5 hotstart polymerase was used. The enzyme should be out of the fridge for the least amount of time possible.
PCR cleanup is used to purify what was obtained from the PCR procedures. dNTPs and polymerase contaminants are removed from the solution. DNA sample will be lost if the buffers are not prepared according to what is said in the protocol. The wash solution contains ethanol (must be added). If the container is left open, the ethanol will evaporate affecting further uses of the wash solution.
Conclusion
The gene that was obtained will be inserted into the pNIC-bsa4 plasmid (purified through midi-prep). The gene will be used to express our target protein.
PCR Cleanup
10/27/2014PCR squared
10/13/2014Midi-prep Trial 2
10/14/2014Analysis
The second trial gave a higher yield of pNIC-Bsa4. Factors that improved to increase the yield are that previous practice of the protocol helped to make no mistakes (avoid any back pressure on the filter and improvement in the amount of time spent on the procedure) , that the filter did not break (during the first trial it leaked), and that the plasmid was placed in a smaller volume of liquid. Nevertheless, the yield was still small as decreasing the volume of the first trial would have given a concentration higher than that if the second trial.
10232014- Fantastic, job well done!
Weeks 5, 6 & 7
Primary and Secondary PCR
Analysis
The PCR gels show that the procedure was done correctly and the DNA sequence was formed. It is still likely that there are some contaminations or that there is a DNA sequence with about the same size of our gene. Sequencing must be done in order to prove that the sequence wanted is there.
Three gels were made. The first one (Figure 1) showed almost no results. There were some signs of a smear, but it did not show bands that could give a conclusion. This was most likely due to using the wrong amounts of sample and blue juice for the gel. The sample was too diluted. Then, a second gel was made instead of repeating the Primary PCR protocol, to confirm that the gel was not showing a false negative. The second gel showed that both PCR procedures worked, although Secondary PCR was still too light. After that, Secondary PCR was repeated, but this time, instead of using the first and last oligonucleotides, custom primers were used to make the DNA. The last gel (Figure 3) showed a dark band at the expected size.
The next step would be to use the PCR squared technique to make more DNA before purifying and sequencing.
11/10/2014
10/06/2014
10/3/2014
Midi- prep
Analysis
Midi-prep is a technique used to isolate the plasmid expressed in bacteria. The plasmid is used for cloning, but it needs further preparation after being purified. The midi-prep procedure uses a series of filter and elutions that wash the unwanted components of the cell leaving only the plasmid. After midi-prep is done, the concentration of the product is checked using Nanodrop Spectrophotometry. The concentration obtained was low. A higher value is more convenient to use on further procedures.
10/02/2014
PCR Primer Design Tails for pNIC-Bsa4 Cloning
09/29/2014
Analysis
Designing PCR Primers requires being careful when working with the DNA sequences. The right sequence should be used (optimized sequence or original) depending on the organism that will be used to express the protein. The programs (online) used to design primers are able to identify where the enzyme is going to cut. It is also possible to simulate an agarose gel to know what to expect when doing the procedures.
Conclusion
The procedure is the step before secondary PCR can be done. The primers will be used to make more copies of the DNA of interest. Knowing where the DNA will be cut is essential to be able to confirm that the plasmid was cut in the right places. If the plasmid is cut properly, gene insertion will be possible to continue with cloning.
Weeks 3 & 4
PCR Primer Design for Overlap Assembly
Analysis
The nucleotide sequences that were found will be used as the pieces of the gene wanted. The sequences will bind in an specific order when Primary PCR is done. The sequences will overlap based on their ends. MPtpA will be formed to be later used for cloning. It will be inserted into the pNIC-bsa4 plasmid.
09/12/2014
Oligonucleotides needed:
1 ATGTCTGACCCGCTGCACGTTACCTTCGTTTGCACCGGTAACATCTG 47
2 CAGTTGTTGCGCGAACATTTTTTCCGCCATCGGAGAACGGCAGATGTTACCGGTGCAAAC 60
3 AATGTTCGCGCAACAACTGCGTCACCGTGGTCTGGGCGACGCGGTTCGTGTTACCTCTGC 60
4 GCTCATCCGCGCAAGAACCAACGTGCCAGTTACCAGTACCCGCAGAGGTAACACGAACCG 60
5 TTCTTGCGCGGATGAGCGCGCAGCCGGTGTTCTGCGTGCGCATGGTTACCCGACCGACCA 60
6 CAGGTCTGCCGCCAGGTGTTCGGTACCAACCTGGGCCGCACGGTGGTCGGTCGGGTAACC 60
7 CCTGGCGGCAGACCTGCTGGTTGCGCTCGACCGCAATCACGCACGTCTCCTGCGCCAACT 60
8 GTCGAAAGAACGCAGCATACGAACACGTGCCGCTTCAACACCCAGTTGGCGCAGGAGACG 60
9 GTATGCTGCGTTCTTTCGACCCGCGTTCTGGTACCCACGCGCTGGACGTTGAAGACCCGT 60
10 TAACCGCGAAAACTTCTTCAAAGTCAGAGTGGTCACCATAGTACGGGTCTTCAACGTCCA 60
11 TTTGAAGAAGTTTTCGCGGTTATCGAATCTGCGCTGCCGGGTCTGCACGACTGGGTTGAC 60
12 TTAAGACGGACCGTTACGCGCCAGACGTTCGTCAACCCAGTCGTGCAG 48
Weeks 1 & 2
-Transformation
September 2, 2014
-Nanodrop Results